mouse agps crispr cas9 ko plasmids Search Results


99
New England Biolabs p8107s cas9 nuclease neb
P8107s Cas9 Nuclease Neb, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/Proteinase+K/pm33421369-416-210-213
Average 99 stars, based on 1 article reviews
p8107s cas9 nuclease neb - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

94
Genecopoeia scl 76321 g2 a549 cas9 p11 ko cells
Scl 76321 G2 A549 Cas9 P11 Ko Cells, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/Human+cell+line+A549+stably+expressing+CRISPR+Cas9%2C+AAVS1+inserted%2C+single+clone/pm36893734-644-200-198
Average 94 stars, based on 1 article reviews
scl 76321 g2 a549 cas9 p11 ko cells - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

91
Addgene inc prs316 tef1p cas9 cyc1t snr52p pac3846 pcas9 plasmid
Prs316 Tef1p Cas9 Cyc1t Snr52p Pac3846 Pcas9 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/pRS316+FOB1+(Plasmid+%2361876)/med_rxiv__2023__10__24__23297197-156-1-16
Average 91 stars, based on 1 article reviews
prs316 tef1p cas9 cyc1t snr52p pac3846 pcas9 plasmid - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

96
Addgene inc cas9 activity
Cas9 Activity, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/CRISPR-SP-Cas9+reporter+(Plasmid+%2362733)/pmc08897436-349-46-23
Average 96 stars, based on 1 article reviews
cas9 activity - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Addgene inc crispr cas9 knockout shrnas against human rab27a
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Crispr Cas9 Knockout Shrnas Against Human Rab27a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/Human+CRISPR+Knockout+Library+(H3)+(Pooled+library+%23133914)/pm37805922-233-32-61
Average 93 stars, based on 1 article reviews
crispr cas9 knockout shrnas against human rab27a - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Danaher Inc cas9 nuclease v3
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Cas9 Nuclease V3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/Alt-R+S%2Ep%2E+Cas9+Nuclease+V3/bio_rxiv__2021__09__16__460522-234-0-3
Average 96 stars, based on 1 article reviews
cas9 nuclease v3 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
New England Biolabs cas9 protein
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Cas9 Protein, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/Cas9+Nuclease%2C+S%2E+pyogenes/pm41075995-238-0-5
Average 96 stars, based on 1 article reviews
cas9 protein - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
New England Biolabs cas9 mrna
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Cas9 Mrna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/XhoI/pmc08570527-44-0-7
Average 99 stars, based on 1 article reviews
cas9 mrna - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Integrated DNA Technologies cas9 protein
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Cas9 Protein, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/Cas9+Nuclease/pmc08688563-249-23-25
Average 99 stars, based on 1 article reviews
cas9 protein - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

98
New England Biolabs cas9 nuclease
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Cas9 Nuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/Cas9+Nuclease/pm36124130-75-49-54
Average 98 stars, based on 1 article reviews
cas9 nuclease - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

98
Integrated DNA Technologies generic tracrrna
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Generic Tracrrna, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/tracrRNA/pmc07486383-308-7-9
Average 98 stars, based on 1 article reviews
generic tracrrna - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

98
New England Biolabs engen spy cas9 recombinant protein
Figure 7. Targeting <t>Rab27a</t> by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).
Engen Spy Cas9 Recombinant Protein, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+agps+crispr+cas9+ko+plasmids/EnGen+Spy+Cas9+NLS/pm41330374-626-11-16
Average 98 stars, based on 1 article reviews
engen spy cas9 recombinant protein - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

Image Search Results


Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Journal: Cell reports

Article Title: Upregulation of exosome secretion from tumor-associated macrophages plays a key role in the suppression of anti-tumor immunity.

doi: 10.1016/j.celrep.2023.113224

Figure Lengend Snippet: Figure 7. Targeting Rab27a by siRNA-loaded LNPs sensitized tumors to anti-PD-1 antibody (A) Heatmap showing scaled expression values of RAB27A, RAB27B, MADD, HGS, PDCD6IP, and TSG101 in four clusters of cells, including B cells (BCs), plasma cells (PCs), monocytes/macrophages (TAM), and dendritic cells (DCs).

Article Snippet: Murine TNF-a: 50-GGTGCCTATGTCTCAGCCTCTT-30 and 50-GCCATAGAA CTGA TGAGAGGGAG-3’; Murine IL-1b: 50- TGGACCTTCCAGGATGAGGACA-3’; Murine IL-6: 50-T ACCACTTCACAAGTCG GAGGC-30 and 50- CTGCAAGTGCATCA TCGTTG TTC-3’; TGF-b: 50-TGATACGCCTGAGTGGCTGTCT-3’; GAPDH: 50-CATCACT GCCACC CAGAAGACTG-30 and 50-ATGCCAGTGAGCTTCCCGTTCAG-3’. shRNA knockdown and CRISPR-Cas9 knockout shRNAs against human RAB27A (NM_004850, GCTGCCAATGGGACAAACATA, CAGGAGAGGTTTCGTAGCTA),96 mouse RAB27A (NM_001301230.1, CGAAACTGGATAA GCCAGCTA, GACAAACATAAGCCACGCGAT), human MADD (NG_029462.1, CCACAAGT ACAAGACGCCAAT, CCTGAAAGTATTTGGGCTAAA), mouse MADD (NM_001177720.1, CCACAAGTACAAGACGCCAAT, CCGCTCATTTATGGCAATGAT) or scrambled shRNA (Addgene, Catalog Number:1864) were co-transfected with viral packaging plasmids to package lentiviral particles using HEK293T cells.

Techniques: Expressing, Clinical Proteomics